To understand the baboon
The Triumph of Evolutionary Methods
Bibliographic Data
| ID | 2043726 |
|---|---|
| Authors | K M Wei (0000-0002-2528-9993) |
| Year | 2012 |
| Volume | 21 |
| Issue | 4 |
| Pages | 131-135 |
| Publication date | 2012-07-01 |
| Peer Reviewed | Yes |
| Open Access | Yes |
| Type | ARTICLE |
| Venue | Evolutionary Anthropology Issues News and Reviews (JOURNAL) |
| Journal identifiers | ISSN: 1060-1538 • E-ISSN: 1520-6505 |
| Publisher | Wiley (PUBLISHER • GB) |
| DOI | 10.1002/evan.21317 |
| PMID | 22907866 |
| OpenAlex | W1756747716 |
| Language | EN |
| Citations received | 3 |
| References cited | 7 |
There was recently a great stir over whether a giant experiment in Europe showed that a tiny subatomic particle, the neutrino, can travel faster than light does (Fig. 1). If early news releases were true, it would be a major finding, because for over 100 years it has been assumed that nothing can travel faster than light, which moves at 299,792,458 m/second. It is an assumption of deep import that every photon everywhere in the cosmos always travels at exactly this speed, give or take nothing (in a vacuum slightly less, but since there isn't any actual vacuum anywhere, slightly less, but never more). Even the new findings rested on just a 60 nanosecond difference in travel time between light and neutrinos. Faster than a speeding neutrino, shaded to make it easier to see. Don't even blink. At 299,792,458 m/sec, it goes by pretty fast! We don't have perfect measurements even on galactic scales of astronomy, but the key assumption is that it's only the measurement, not the theory, that is in error. Any deviation from the literal maximum speed is not the result of a probabilistic process like, say, the probability (1/2) of Mendelian transmission from parent to offspring, because the law is a rigid rather than probabilistic truth. Life is a physical phenomenon, and many manifestations of physics and chemistry in life work as expected: molecular interactions, fluid pressure in blood circulation, the effects of gravity on hair cells in the semicircular canals, tortional strength of bone, molecular flow across ion gradients at cell surfaces, and more. Some of these, like pressure, seem probabilistic in the normal way, resulting from the presumably random buzzing around of countless identical molecules, the same principles that work everywhere in the cosmos in precisely the same way. But, perhaps perplexingly, the same kind of specificity is not found in higher levels of explanation of life, and in particular, its evolution. If evolution had a satisfactory theoretical core, by these standards it should be exceedingly difficult to discover anything truly "revolutionary." So why will the next fossil finger bone be proclaimed by us, the news media, and a Nature cover story to revolutionize our whole understanding of human evolution? Similar hyperthermia applies to claims of genetic causation of any trait one can imagine. Evolution is as central to life as the speed of light is to physics, but in a fundamentally different way. It is a big challenge, but that shouldn't generate physics envy: evolution is essentially imprecise and not rigorously "law-like," as are the core of physics and chemistry.1 Nonetheless, we do have a transformative theoretical basis, described as the "Darwinian method," in a fine book about its triumph, by Michael Ghiselin more than 40 years ago.2 It is worth considering this strange situation in which we have a pervasive underlying theory, yet don't nearly have rock-solid or precise predictive laws to match those explaining neutrinos. So what kind of theory is evolution? Adam Sedgwick (1785-1873) was a geologist and one-time friend and teacher of Darwin's. But he was a strong Christian fundamentalist, and when he learned of Darwin's theory of evolution, he strenuously objected. He justified this not on theological grounds, but because Darwin's theory rested on a violation of an accepted fundamental principle of the scientific method. Among others, the Enlightenment philosopher Francis Bacon (1561-1626), in his 1620 book Novum Organum, had suggested that scientific understanding does not come from inspiration, basic principles innately born in the brain from which predictions about the world were deduced through logical reasoning, as had been common practice from Aristotle and the classic Greeks until Galileo's time. Instead, Bacon said that understanding of the world comes first and foremost from repeated observation through a process of induction, an assembly of facts collected without misleading preconceptions, from which the generalization that we call theory would emerge. At that point, new facts could be predicted. This view had become orthodoxy by Darwin's time. Sedgwick argued that since Darwin didn't follow it, evolution wasn't science! In a letter to Darwin, Sedgwick wrote: "I have read your book with more pain than pleasure. Parts of it I admired greatly; parts I laughed at till my sides were almost sore; other parts I read with absolute sorrow; because I think them utterly false & grievously mischievous-You have deserted-after a start in that tram-road of all solid physical truth-the true method of induction-& started up a machinery as wild I think as Bishop Wilkin's locomotive that was to sail with us to the Moon. Many of your wide conclusions are based upon assumptions which can neither be proved nor disproved. Why then express them in the language & arrangements of philosophical induction? - As to your grand principle-natural selection-what is it but a secondary consequence of supposed, or known, primary facts" (http://www. darwinproject.ac.uk/entry-2548). Anthropologists may recognize similar arguments made later by the ethnologist Franz Boas against general theories of culture. In fact, there is evidence that some of Darwin's work was written "backwards" relative to this methodological orthodoxy, in the sense that he had an idea first and then collected facts or did analysis afterward to prove the idea.4 Darwin claimed he had worked on Baconian principles without preconceived theory, but his letters and notebooks show that his idea of evolution developed shortly after he returned from his Beagle trip.5 After the Origin was published, but without mentioning Sedgwick, Darwin indirectly acknowledged and defended his method: "In scientific investigations it is permitted to invent any hypothesis, and if it explains various large and independent classes of facts it rises to the rank of a well-grounded theory."3 Darwin's works were chapter and tome of this method in action, a mix of deduction and induction.5, 6 He was a voracious collector of data, but also, and at the same time, one of the grandest synthesizers in the history of science. Unlike a classical Enlightenment scientist - a Galileo, say - he couldn't come to understand basic nature by rolling balls down an inclined plane in his house, where any ball would do, dropping things from a nearby tower, or considering what he could see out his window with a simple telescope. In contrast, the world may have been his oyster (or, perhaps, his barnacle) but Darwin had to synthesize pattern out of global data of all sorts, only a trifle of which he saw or collected himself. If his approach included methods forbidden by Enlightenment orthodoxy, he stuck to his theoretical guns anyway, because at some level he knew his ideas contained fundamental truth. He used evidence appropriately and acknowledged where he might be making assumptions or where his intuition laid. He was inconsistent, but who isn't? Today we routinely mix induction and deduction, often implicitly and obeying no rigid rules of inference. This reflects the complex nature of scientific investigation, in which ideas, observations, prejudices, predilections, competition, status, beliefs, tribalism, funding, and just plain luck are all part of the enterprise that leads to the moveable feast of an informal consensus. We're not constrained by induction, deduction, falsification, parsimony, or any other single criterion (except, perhaps lack of funding). It also does not matter what Darwin said about how he operated. What's important is his conceptual legacy: the triumph of his method. This doesn't mean that we all agree. Indeed, if we did, it wouldn't be science. The idea of evolution as an historical process of change with continuity over time has widespread applications. Darwin's startling success was in providing a framework for understanding life. As the leading contemporary philosopher John Stuart Mill described it, "It is unreasonable to accuse Mr. Darwin (as has been done) of violating the rules of Induction. The rules of Induction are concerned with the conditions of Proof. Mr. Darwin has never pretended that his doctrine was proved. He was not bound by the rules of Induction but by those of Hypothesis. And these last have seldom been more completely fulfilled. He has opened a path of enquiry full of promise, the results of which none can foresee"7 (Fig. 2). Mill's book of rules (1843). (Source: Google books.) Mill himself was never convinced there was proof,6 but Darwin's ideas took hold and, in fact, his greatest contribution was not a massive body of facts, but the development of a useful theory.2 That this is true is shown by how quickly Darwinism was borrowed to explain changes and variation in society, including archeology, cultural anthropology, personal interactions and behavior, economics, changes in institutions such as universities, and even the evolution of the universe.8 But how can ideas be specific enough to form a core theory of life and yet seem to apply so widely, often with little alteration, to such diverse areas of investigation? A generic answer to this question is that things with similar form need not be identical in underlying process. Evolutionary thinking clearly may work in these various areas, but each has its own details and different types of causal elements, and in no case does the fit have anywhere near the rigor or precision of physics. The Darwinian method compares general patterns of phenomena involving individually unique components. In Darwin's view, and ours by inheritance, the formation of each species is a unique event. We use the Darwinian method, a conviction born of both induction and a global deductive hypothesis to which facts are fitted. The method is the application of the principles of descent from common origin and differential proliferation of inherited factors. Even today, most biologists are so staunch in defense of both common ancestry and natural selection as the core causal processes that many simply won't accept or even look for serious nuances, such as the importance of chance in the form of genetic drift. Even if an excessive commitment to the Darwinian principles as axioms, or even dogma, can be misleading, the approach is ubiquitously applied and has proven to be exceedingly powerful. It allows prediction of new things, as a good theory must, but because it is about general pattern and is not precise, many different things can be brought under its tent. The principles are flexible enough to be easily consistent with vertical parent-offspring as well as horizontal transfer (such as by mitochondria, chloroplasts, or viruses), and fine-tuned adaptation as well as selectively neutral evolution. Even if it were seeded here from outer space, only the when and where of life would change, not the basic principles or their application. But this flexibility comes at a price. The probabilistic nature of evolutionary processes necessitates the statistical nature of our data. Differential proliferation may be a central tenet but, since there are many ways for things to proliferate, the most central core of evolution becomes rather unfalsifiable. That can be a problem, but there is nothing overall about the consistency of data to the general evolutionary assumptions that seems forced or uncomfortable. In fact, the Darwinian method can even find order in randomness. Box 1. Partial Sequence of the ApoE Gene Box 1. Partial Sequence of the ApoE Gene Statistically, this is essentially a random string, but you and I are proof that it's packed with information. That may be mind-bending, as is the fact that a couple of nucleotide changes in this gene can give you real dementia! Some of the functional elements of ApoE are shown schematically in Figure 3. DNA is crowded with such elements. These are understood by comparative or experimental data that ultimately rest on the Darwinian method, applying assumptions about common ancestry and evolutionary processes. Because of descent from a common ancestor, even the nonfunctional parts of sequences are not random, in the phylogenetic sense that they are similar among closely related species. The ApoE gene, a partial sequence of which is shown in Box , annotated for functions known by various experimental and evolutionary means. Top two lines are the scale of nucleotide positions along chromosome 19, then the gene itself (boxes are protein coding regions; the connecting line represents introns, or noncoding interrupting regions). Three lines then show the location of sequences that regulate the cellular expression of the ApoE gene; two lines of gray-shade identify sequence regions respectively conserved among mammals and vertebrates; finally, the bottom line shows segments of DNA such as virus DNA that are inserted in the genome from time to time. From the UCSC genome browser (genome.ucsc.edu). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.] Evolution unites our recognition of both pattern and its evolution, because history preserves functional and nonfunctional parts of DNA, but at different overall rates. And what is most telling in this regard is the remarkable fact that even though each specific functional element has its own unique history of descent and adaptation, the generic connection between history and pattern remains. Induction is used here: relatives of the same degree replicably share sequence similarity across their genomes to a similar degree. However, the specifics differ from region to region of the genome, and between every pair of relatives of any species that you could test. Again, this makes complete sense as a deductive consequence of the assumptions of similar mutational processes and the nature of shared ancestry. This leads to predictions such as that a similar sequence will be found in the next new mammal species having a genome that is sequenced, but not in some species from undersea thermal vents. And it's why pedigree analysis and gene mapping among people from the same population (that is, who share recent ancestry) can find variants in different individuals that are associated with similar traits such as disease.9 Such methods are implicit uses of the brilliant Darwinian insight. Deduction is also used in many other ways, for example by using known patterns of regions of DNA that code for proteins to identify new coding regions in a newly available sequence, even for proteins that have never been seen before. We can see this in a different way from the following little sequence: GGGCTATTCAACGAGCCTAGGCTA TACGCTACTGACCTGTCACGCCTTT GCT. The Genbank DNA sequence repository (http://www.ncbi.nlm.nih.gov/ genbank/) reports that there was " no significant similarity found" between this and any known sequence. That is rather remarkable, given how much sequence there is on file from essentially every major branch of the tree of life, and that similarity searches allow for some mismatches. If this were from a reptile or tree species, a bird, fish, or fowl, grape, grain, or maiden, we should be able at least to see its similarities to the appropriate most-closely related species. But...nothing. If our theory of life is even remotely correct, such a result is exceedingly hard to explain other than by assuming that there is a branch of life unrelated to anything yet discovered; this is from part of the genome that hasn't been sequenced before in any species even modestly related to the sample; there is an entirely independent type of DNA-using life dropped here from outer space; or I made it up. You decide. Life as history is so nonrandom that even the observed randomness of DNA sequence is nonrandom. An actual case in point involves so-called orphan genes, found in one species or taxonomically restricted group but having no known relatives anywhere else in the biosphere. Orphan genes may have had some narrow adaptive function that was important to the evolution of their species, explaining their absence elsewhere.7 But that seems to challenge the fundamental assumption of the evolutionary method, that life is a single universally connected phenomenon. Where would such genes have come from, leaving no trace in other taxa? Several ideas have been offered.7, 10 For example, their ancestral relatives may not have been useful to other species and were mutated away. Probably more fancifully, the regulatory sequence may have arisen by mutation fortuitously near to coding sequence.10 Whatever the specifics, orphan genes are exceptions that test the rule, because the only reason they're recognized in the first place is that they are genes: they have the sequence-based structures of coding regions, splicing, transcription start and stop signals, and so on, as we know them from the rest of life. So while they may be unique in the world today, they were not dropped to earth from outer space. Orphan genes require no suspension of the rules of life and make no rent in the connected fabric of life. Indeed, understanding them actually shows the Darwinian method in action. The Rubaiyat of Omar Khayyam is a poem about love, as nature's Paradise. It's true: from a Darwinian point of view, the wine, the bread, and the lover are all related. Their DNAs have orderly patterns of similarity that make more sense in evolutionary terms than by any other known criterion. In his 1838 notebook "M", Darwin scribbled that "He who understands baboon would do more towards metaphysics than Locke" (http://darwin-online.org.uk/EditorialIntroductions/vanWyhe_notebooks.html). That's a popular quotable quote for scientists because Darwin meant that the classical approach of introspective philosophy can tell us less about human nature than can looking directly to nature by observing the behavior of the baboon, our evolutionary relative, even though not human itself. Indeed, a nice book has recently been written in this spirit.11 "Let Nature be your teacher.... One impulse from a vernal wood May teach you more of man; Of moral evil and of good, Than all the sages can. Sweet is the lore which nature brings; Our meddling intellect Mishapes the beauteous forms of things; -We murder to dissect."12 To Wordsworth, as to most pre-Darwinian scientists, nature was a guide to God's harmonious creation, not to cruelly connected historical processes. This was the very opposite of Darwin's view. Of course, there isn't just one lesson to learn from nature. Much of what is anthropologically most about has to do with not the of our or In this Darwin's of rather and cultural Even if there is less to learn about life by considering theories than by the baboon, there may also be little to by how Darwin did or didn't follow methodological of his time, which we call the scientific or method. Darwin did not invent the method. It was developed in physics, and some areas of the Even the Darwinian method, as as it has proven to we often have We always are to new that has never worked to any methodological We have always our to explain why the world is as we find Darwin in his time, and we today, each case a perhaps a say, for the same law applies to all and or the same gravity to all solid dropped from any while the method is one we and we do it with the same as did the Baconian of induction, or the and other of that we that our orthodoxy is the last and only way to understand the we do have a theory that applies to and evolutionary with individually unique individuals in terms of their in It is the of the example, and that the of the of individuals in the next Evolution is about the statistical of whether of genes in in cells in individuals in or species in made Darwin so was not his precision or he made of and from data. But life had been to be the of laws like those of physics, and he showed how to it the same tent. and the methods they were general and, in their way, as as other natural If there is a problem, it's in the not the Even application of the Darwinian method allows a of and it seems to invent any As as the method is, there is often little way function to selection to such as how or We use functional evidence to adaptive that we be or we use relatives common ancestry) to in such as the evolution of in like Darwin, the evolution of the and in But this wide for rather and the of data to prejudices, just as Sedgwick, and Mill evolutionary come and faster than a speeding used to think that very but, as of this have found that along at light That may be an that life is that no precise theory to those of physics and chemistry is that to be the In a based on random change is the of evolution, so that the theory itself is not it's just not as predictive its less as much of physics and the the of perfect prediction was in many areas, implicitly including evolution, by statistical in to probabilistic causation rather than predictions of specific the in evolution and the of traits by genes are one might say we recognize probabilistic prediction as form of deduction, we don't have a deductive way to from theory the way For that to be the have some that is, they have actual probability based in from which to the of Such may not apply to It may seem but make no scientific sense to for example, what the probability was that would out of years In the to probabilistic thinking is an important because it is that are individually rather than but in ways we simply out how to will but Darwin would have no with what today, or with the triumph of his method. we well without even more than of theories of inference. his was a scientific theory or as Sedgwick is we can to to For many on the scientific method and Darwin's see a of at I on this I a on at I and John for this This is written with from to
Baboon · Biology · Evolutionary biology · Geography · Zoology · Bat Biology and Ecology Studies · Human-Animal Interaction Studies · Primate Behavior and Ecology · Ecology
| Unique citing works | 3 |
|---|---|
| Citations per year | 0,23 |
| Citation span | 2013 - 2017 (5) |
| Citation velocity | historical |
| Highly cited | No |
| Citation types | Neutral: 3 |